Protocols & Troubleshooting Guides
      Back to home
      1. Resource Center
      2. Protocols & Troubleshooting Guides

      What is the CircRNA (Circular RNA) Group I Method 1?

      The self-splicing mechanism of Group I introns involves two transesterification reactions. The first reaction is the formation of a branched intermediate and the second reaction is the release of the intron and the ligation of the two exons.

      Materials and Instruments

      • Instruments

      Instrument

      Brand

      Cat No.

      Gel Imaging System

      Bio-Rad

      chemidoc

       

      • 10x TBE buffer (Not Provided):

      108g Tris-HCI, 7.44g EDTA, 55g Boric Acid, pH=8.3, dissolved in 1L water

      • 4% Urea-PAGE (Not Provided) (For 20mL):

       

       

      Reagent

      Amount

      Brand

      Cat No.

      System Buffer

      2 mL

      National Diagnotistics

      EC-835

      System Concentration Buffer

      3.3 mL

      National Diagnotistics

      EC-840

      System Dilution Buffer

      14.7 mL

      National Diagnotistics

      EC-828

      30% APS

      50 mL

       

       

      TEMED

      10 mL

       

       

       

      How to make 4% Urea-PAGE Gel?

      1. Place the two pieces of glass together and seal the edges and bottom to create a gel mold.
      2. Prepare the Urea-PAGE and add APS and TEMED, according to the manufacturer's instructions [National diagnostics].
      3. Quickly transfer the Urea-PAGE into the gel mold and place a comb on top to create wells for sample loading.
      4. Place the gel in the running box and fill it with 1x TBE buffer.
      5. Pre-run the gel at a constant 12W for 30 minutes to ensure even separation.
      6. Using a syringe, carefully wash out any remaining urea in the wells.
      7. The Urea-PAGE is now ready to be used for sample separation.

      Experimental Procedure

      1. Prior to the experiment, remove the reagent from the -20°C freezer and allow it to thaw on ice.
      2. Ensure that the entire process is conducted in an RNase-free environment to maintain the integrity of the IVT system.
      3. Follow the recipe below to set up the IVT reaction:
      4. T7RNAP and the DNA template are the last items to be added.
      5. After the IVT reaction, 2-5 μL of the IVT product should be separated on a pre-run 15% urea-PAGE at a constant 12W for 1-2 hours.
      6. Stain the gel with dimethyl solution for 5 minutes, and de-stain it with water until the dye disappears.
      7. Visualize the gel using a Gel Imaging System (Bio-Rad, Chemidoc) in the Coomassie blue channel.

      IVT Reaction

      1. Initiate the IVT reaction at 37°C for 17 hours.
      2. Digest the DNA template using DNase I (4U/μL) (KACTUS, GMP-DNI-EE001-11) at 37°C

      for 30 minutes.

      3.   Purify the RNA from the reaction mixture using either LiCl precipitation or column purification techniques.

      Reagent

      Amount (uL)

      Cat No.

      Linearized DNA for yield (100ng/uL) [1193 nt transcript]

      2

       

      5x Buffer II

      4

       

      NTP (5mM/each)

      4

       

      Murine RNase Inhibitor (40U/uL)

      0.5

      Kactus, GMP-RNI-ME101-11

      Pyrophosphatase, Inorganic (0.1U/uL)

      0.5

      Kactus, GMP-PYR-YE101-11

      T7 RNAP

      2

       

      ddH­2O

      4

       

       

      LiCl Precipitation

      1. For LiCl precipitation, add LiCl solution to the IVT reaction at a 2.5M final concentration and place it in a -20°C freezer for 30 minutes.
      2. Centrifuge the mixture at 16000g for 15 minutes and discard the supernatant carefully.
      3. Use 50-100μL 70% ethanol to wash the precipitant and centrifuge at 16000g for 5 minutes.
      4. Repeat the previous step 2 times to clean the precipitant.
      5. Dry the precipitant in the fume for about 15-30 minutes until the ethanol is completely gone.
      6. Dissolve the precipitant in 50-150μL RNase-free water.
      7. Measure the purified RNA on Nanodrop to confirm its concentration.
      8. The purified RNA can be directly used for later experiments or frozen by liquid nitrogen and stored at -80 °C.

      Column Purification

      1. Follow the instructions provided by the supplier.
      2. Measure the purified RNA on Nanodrop to confirm its concentration.
      3. The purified RNA can be directly used for later experiments or frozen by liquid nitrogen and stored at -80 °C.

      To Analyze Purified RNA

      1. Add purified RNA of 100-500 ng into a tube and mix with 2x Urea loading buffer (Provided).
      2. Incubate the mixture at 65°C for 3 minutes, followed by 4°C for 1 minute.
      3. Separate the mixture on a 4% urea-PAGE gel with a constant current of 12W in 0.5 hours under 1x TBE buffer condition.
      4. After separation, stain the gel with Safe Green Plus solution (diluted 1:10000 with water:Powder Provided) for 5 minutes.
      5. Visualize the gel on the Gel Imaging System (Bio-Rad, Chemidoc) in the nucleic acid

      channel.

       

      Template sequence information (Ty promoter in [ ]):

      [TAATACGACTCACTATA]GGGTTCTCAACACAACATATACAAAACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTCTTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGCGAATTCGCCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAGT

      1. Weissman, , Pardi, N., Muramatsu, H. & Kariko, K. HPLC purification of in vitro transcribed long RNA. Methods Mol Biol 969, 43-54 (2013).