How to determine RNA Yield

Step-by-step instructions for the determination of RNA yield.

Materials and Instruments:

• Instruments:

Experimental Procedure

IVT and RNA purification

1. Prior to the experiment, remove the reagent from the -20°C freezer and allow it to thaw on ice.
2. Ensure that the entire process is conducted in an RNase-free environment to maintain the integrity of the IVT system.
3. Follow the recipe below to set up the IVT reaction:
4. T7 RNAP and the DNA template are the last items to be added.

IVT Reaction

1. Initiate the IVT reaction at 37°C for 2-3 hours.
2. Digest the DNA template using DNase I (4U/μL) (KACTUS, GMP-DNI-EE001-11) at 37°C

for 30 minutes.

1. Purify the RNA from the reaction mixture using either LiCl precipitation or column purification techniques.

LiCl Precipitation

1. For LiCl precipitation, add LiCl solution to the IVT reaction at a 2.5M final concentration and place it in a -20°C freezer for 30 minutes.
2. Centrifuge the mixture at 16000g for 15 minutes and discard the supernatant carefully.
3. Use 50-100μL 70% ethanol to wash the precipitant and centrifuge at 16000g for 5 minutes.
4. Repeat the previous step 2 times to clean the precipitant.
5. Dry the precipitant in the fume for about 15-30 minutes until the ethanol is completely gone.
6. Dissolve the precipitant in 50-150μL RNase-free water.
7. Measure the purified RNA on Nanodrop to confirm its concentration.
8. The purified RNA can be directly used for later experiments or frozen by liquid nitrogen and stored at -80 °C.

Column Purification

1. Follow the instructions provided by the supplier.
2. Measure the purified RNA on Nanodrop to confirm its concentration.
3. The purified RNA can be directly used for later experiments or frozen by liquid nitrogen and stored at -80 °C.

RNA Analysis by CE

1. Adjust RNA to 100ng/μL.
2. 2μL sample is mixed with 16μL ddH2O and 2μL dilution buffer followed by 72°C treatments in 5min and 4°C in 3min.
3. Then the sample is loaded on the capillary electrophoresis machine (Qsep1-Plus, Jiyuan Bio-Tech).
4. The procedure is referred to the suppliers.
5. The purity and molecular size of RNA will be shown as a spectrogram.

Template sequence information (Ty promoter in [ ]):

[TAATACGACTCACTATA]GGGTTCTCAACACAACATATACAAAACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTCTTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGCGAATTCGCCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAGT